
Hjælp til at finde 4 aminosyrer haster

20. april 2019 af Lara45 - Niveau: A-niveau


Er der nogle der kan forklare mig hvordan jeg finder de 4 første aminosyrer på vedhætet billede?

PÅ forhånd tak

Brugbart svar (0)

Svar #1
21. april 2019 af AngelOneOne


En aminosyre består af tre basesekvenser. Du finder derfor de fire første 3-base sekvenser, og identificerer hvilke aminosyrer de koder for, ud fra nedenstående skema:

Den første i din sekvens (CCA - Husk at DNA aflæses i 3'→5' retningen, men skrives i 5'→3' retningen) koder f.eks. for prolin jvf. ovenstående.


- - -

"The Universe is under no obligation to make sense to you" - Niel deGrasse Tyson

Svar #2
22. april 2019 af Lara45

Mange tak, men til eksamen har jeg kun denne på vedhæftede billede til at aflæse aminosyrerene udfra. Derfor er det vigtigt at jeg forstår at aflæse aminosyrer ud fra den. 

Når jeg kigger på den og aflæser fx. CCA, så får jeg Thr. 

Det forstår jeg ikke. Kan du måske forklare mig, hvordan jeg aflæser den rigtige aminosyrer ud fra figuren?

På forhånd tak

Svar #3
22. april 2019 af Lara45

#1 Men jeg forstår ikke hvordan kan jeg aflæse de 3 andre aminosyrer, som indeholder T, som ikke er en del af mit skema. 

Hvad gør man så?

Brugbart svar (1)

Svar #4
22. april 2019 af AngelOneOne


Princippet i dit skema er det samme som i cirklen. Første bogstav er til venstre - Så bevæger du dig vandret ud til den lodrette kolonne der har bogstav nr 2 øverst og matcher så en af de fire aminosyrer iu det felt du er havnet med, med den række for det tredje bogstav. I CAA eksemplet bliver det så 2. vandrette kolonne, 2. lodrette kollonne og 3. aminosyre (af de fire i feltet talt foroven i feltet du er havnet i ved de to første bogstaver) = Pro = Prolin. - Håber det giver mening...

I forhold til T, som du ikke kan læse i stranskriptionsnøglen, så skal du huske på, at transskriptionsnøglen bruges på mRNA - Og i mRNA er Thymin erstattet med Uracil - Så hvor der står T, ville det svare til et U på mRNA.


- - -

"The Universe is under no obligation to make sense to you" - Niel deGrasse Tyson

Brugbart svar (1)

Svar #5
22. april 2019 af AngelOneOne


I følge din nøgle, skal du starte i 5' enden og slutte i 3' enden... Så din kode bliver GGT (hvilket i nøglen svarer til GGU) - Når du gør det, får du Gly - Glycin. Har prøvet at illustrere det:


- - -

"The Universe is under no obligation to make sense to you" - Niel deGrasse Tyson

Svar #6
22. april 2019 af Lara45

#5 Tusind tak. Jeg forstår stadig ikke hvordan man kan læse CCA i mit skema. Jeg tror jeg bliver forvirret, fordi den skal læses fra 3'-5'. Håber du kan hjælpe måske illustrere det ligesom i #5 - det hjalp meget på forståelsen

At læse fra 5' til 3' forstår jeg godt nu :) 

Brugbart svar (0)

Svar #7
22. april 2019 af AngelOneOne


Tror jeg har misforstået din opgave... Jvf. dit skema, skal du læse fra 5' mod 3'...

Skull du bruge det samme skema for at aflæse CCA ville det se sådan her ud:

MEN - Jvf. opgaven og det tilhørende skema, skal du læse fra 5' mod 3' og ikke som jeg kom til at skrive... Du skal altså finde aminosyrerne for kombinationerne GGT (=GGU), AAG, GAG og CAT (=CAU).


- - -

"The Universe is under no obligation to make sense to you" - Niel deGrasse Tyson

Svar #8
22. april 2019 af Lara45

#7 Tusind tak Det hjalp så meget, men jeg et blevet så forvirret.. Du har skrevet at T skal lavet til U, men hvis du ser på vedhæftet skema, så er det A der bliver udskiftet med U.

Kan du måske forklare mig hvorfor eller hvad der er rigtigt?

Brugbart svar (1)

Svar #9
22. april 2019 af AngelOneOne


He, he... Forstår godt du kan blive forvirret over skemaet... Det skemaet viser er hvad den komplementære base er i mRNA i forhold til DNA... Der er kun forskel mellem DNA og mRNA i forhold til hvilken base der er komplementær til A. I DNA binder A sig til T, men i mRNA er T udskiftet med U, så i mRNA er A's komplementærbase U i stedet for T.

I DNA er komplementærbaseparrene A-T, og C-G... I RNA er komplementærbaseparrene A-U og C-G.


- - -

"The Universe is under no obligation to make sense to you" - Niel deGrasse Tyson

Svar #10
22. april 2019 af Lara45

Hej, mange tak. Det giver så meget mening. Jeg skal bare være sikker på, at jeg forestår det 

Et gen har denn basesekvens TTAAATTGTTGTAAGCAGGTT

DNA sekvens oversættes til komplemtært mRNA, dvs. 







Jeg forstår bare ikke hvorfor jeg i ovenstående tilfælde ikke skal bruge U istedet for T.. 

Hvornår ved jeg hvordan jeg skal bruge U istedet for T? 

Brugbart svar (1)

Svar #11
22. april 2019 af AngelOneOne


Ja - Når du støder på et A i DNA, bliver det til et U i den komplementære mRNA.

Når du skal bygge en mRNA ud fra en DNA, skal du jo huske at det er komplementærbaserne til baserne i DNA, der vil udgøre mRNA strengen.

Så har du en DNA streng der hedder AGTC, vil komplementærbaserne i den komplementære mRNA hedde UCAG.

Komplementær DNA/DNA:

Komplementær DNA/mRNA:

Så det du egentlig bare skal huske på er, at hver gang der er et A i DNA, vil det blive til et U i mRNA og omvendt. U bruges kun i RNA og svarer til T i DNA. Så hvor T binder sig til A i DNA, binder U sig til A i RNA (hvis RNA altså havde været dobbeltstrenget som DNA).


- - -

"The Universe is under no obligation to make sense to you" - Niel deGrasse Tyson

Svar #12
22. april 2019 af Lara45

#11 Tusind tak - endenlig giver det mening

Jeg skal bare være helt sikker. Jeg har lavet nedenstående skema, for at få et overblik - er det rigtig forstået?

DNA til aminosyrer

DNA -----> mRNA

A                 U

T                 A

C                G

G                C

mRNA ------> DNA

T                      A

U                      T

G                      C

C                      G

På forhånd tak

Brugbart svar (1)

Svar #13
22. april 2019 af AngelOneOne


Der findes ikke T i mRNA så:

mRNA ----> DNA

U                  A
A                  T
G                 C
C                 G


- - -

"The Universe is under no obligation to make sense to you" - Niel deGrasse Tyson

Svar #14
23. april 2019 af Lara45

#13 Mange tak, men i #11 skrev du U bruges kun i RNA og svarer til T i DNA.

Derfor forstår jeg ikke hvorfor U bliver til A og ikke til T i det du har skrevet i #13. 

Håber du forstår hvad jeg mener. 

På forhånd tak 

Brugbart svar (0)

Svar #15
23. april 2019 af Skiathos (Slettet)

Svar til # 14

Eksempel fra svar # 13

m RNA  U A G C bliver til

DNA (skabelon streng) A T C G, som bliver til

DNA (kodende streng) T A G C


Brugbart svar (0)

Svar #16
23. april 2019 af Skiathos (Slettet)



Er der nogle der kan forklare mig hvordan jeg finder de 4 første aminosyrer på vedhætet billede?

PÅ forhånd tak

               De fire første 4 aminosyrer er (fra 5´ mod 3´)

              DNA kode GGT AAG AGC ATC

             m RNA kode GGU AAG AGC AUC = glycin , lysin, serin og Isoleucin

Svar #17
23. april 2019 af Lara45

#15 Det forstår jeg overhoved ikke. Er der andre der kan forklare det på en anden måde måske?

Brugbart svar (1)

Svar #18
23. april 2019 af AngelOneOne


Baserne binder sig altid til deres komplementære baser... Derfor vil U aldrig kunne binde sig til T, men til T's komplementære base, altså A. Derfor, når du ser et U i mRNA, har der siddet et A på den DNA streng som mRNA er dannet ud fra.


- - -

"The Universe is under no obligation to make sense to you" - Niel deGrasse Tyson

Svar #19
24. april 2019 af Lara45

#18 Okay tak 

Så hvis jeg ser et T i DNA (Og T ses kun i DNA), så er det A den binder til?

Brugbart svar (1)

Svar #20
24. april 2019 af AngelOneOne


Ja - Både i DNA og mRNA... Ser du et A i DNA, vil den komplementære base i DNA være T og i mRNA vil den være U. Ser du et U i mRNA vil den komplementære base i DNA være A. Og som du selv skriver, ser du et T i DNA er den komplementære base være A i mRNA.


- - -

"The Universe is under no obligation to make sense to you" - Niel deGrasse Tyson

Forrige 1 2 Næste

Der er 26 svar til dette spørgsmål. Der vises 20 svar per side. Spørgsmålet kan besvares på den sidste side. Klik her for at gå til den sidste side.